View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_120 (Length: 256)
Name: NF11180A_low_120
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_120 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 11439615 - 11439834
Alignment:
| Q |
19 |
acatcaatgataaaatatctcatagactttggactatacttannnnnnnnnnnnncattgaatggactatacttactttgtgcatgtaaaataaatgaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11439615 |
acatcaatgataaaatatctcatagactttggactatacttatttttttatttttcattgaatggactatacttactttgtgcatgtaaaataaatgaca |
11439714 |
T |
|
| Q |
119 |
ttgatatgtttattttattgaaccattattttatgcatgagatactctagacaatattatttgagtcggggaacacaaaagtcatgcaannnnnnnnnaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11439715 |
ttgatatgtttattttattgaaccattattttatgcatgagatactctagacaatattatttgagtcggggaacacaaaagtcatgcaatttttttttaa |
11439814 |
T |
|
| Q |
219 |
tatatagtccatattagagt |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
11439815 |
tatatagtccatattagagt |
11439834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University