View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11180A_low_124 (Length: 255)

Name: NF11180A_low_124
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11180A_low_124
NF11180A_low_124
[»] chr3 (1 HSPs)
chr3 (29-69)||(4736726-4736766)


Alignment Details
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 29 - 69
Target Start/End: Complemental strand, 4736766 - 4736726
Alignment:
29 attaattgtgagatgagaagtttacaacttattaagattaa 69  Q
    |||||||||| ||||||||||||||||||||||||||||||    
4736766 attaattgtgggatgagaagtttacaacttattaagattaa 4736726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University