View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_129 (Length: 252)
Name: NF11180A_low_129
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_129 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 23333991 - 23333765
Alignment:
| Q |
1 |
ggtgggtaagattggaggtgggtggggtgctctttgcaaggcacggaggctgtaaccaaaacagccattgaagttgggtgtgactcatgacgcggacaat |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23333991 |
ggtgtgtaagattggaggtgggtggggtgctctttgcaaggcacggaggctgcaaccaaaacagccattgaagttgggtgtgactcatgaagcggacaat |
23333892 |
T |
 |
| Q |
101 |
aaggttgtctatctgaagcatgttccttttccatcaatgcagacggacataacgaagttgaccgataaaattgtgtgccagaatgcagctgaagcagtac |
200 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23333891 |
aaggttgtctatctgaagcatcttcgttttccatcaatgcagacggacataacgaagttgaccgataaaattgtgtgccggaatgcagctgaagcagtac |
23333792 |
T |
 |
| Q |
201 |
tcccccaaagaggttgataagtttgtt |
227 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
23333791 |
tccccccaagaggttgataagtttgtt |
23333765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University