View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11180A_low_136 (Length: 250)

Name: NF11180A_low_136
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11180A_low_136
NF11180A_low_136
[»] chr1 (1 HSPs)
chr1 (2-240)||(52016344-52016582)


Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 2 - 240
Target Start/End: Original strand, 52016344 - 52016582
Alignment:
2 gatggacatcagaaaagcacttgaggaccattttacagaaagccctgctagggagctttgcatattaaccacacttgctcggagtgagcctccattactt 101  Q
    ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52016344 gatggccataagaaaagcacttgaggaccattttacagaaagccctgctagggagctttgcatattaaccacacttgctcggagtgagcctccattactt 52016443  T
102 gaagatgctttaaagagaataaaagttatccgtgaaaaggagttgtctcatgctgatgatcacaggagaatgacctacccttctgctgaagaagctttga 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52016444 gaagatgctttaaagagaataaaagttatccgtgaaaaggagttgtctcatgctgatgatcacaggagaatgacctacccttctgctgaagaagctttga 52016543  T
202 aacatctgttgtggttggccgatggggatgctgtctatg 240  Q
    |||||||||||||||||||||||||||||||||||||||    
52016544 aacatctgttgtggttggccgatggggatgctgtctatg 52016582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University