View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_136 (Length: 250)
Name: NF11180A_low_136
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_136 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 2 - 240
Target Start/End: Original strand, 52016344 - 52016582
Alignment:
| Q |
2 |
gatggacatcagaaaagcacttgaggaccattttacagaaagccctgctagggagctttgcatattaaccacacttgctcggagtgagcctccattactt |
101 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52016344 |
gatggccataagaaaagcacttgaggaccattttacagaaagccctgctagggagctttgcatattaaccacacttgctcggagtgagcctccattactt |
52016443 |
T |
 |
| Q |
102 |
gaagatgctttaaagagaataaaagttatccgtgaaaaggagttgtctcatgctgatgatcacaggagaatgacctacccttctgctgaagaagctttga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52016444 |
gaagatgctttaaagagaataaaagttatccgtgaaaaggagttgtctcatgctgatgatcacaggagaatgacctacccttctgctgaagaagctttga |
52016543 |
T |
 |
| Q |
202 |
aacatctgttgtggttggccgatggggatgctgtctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52016544 |
aacatctgttgtggttggccgatggggatgctgtctatg |
52016582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University