View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_141 (Length: 249)
Name: NF11180A_low_141
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_141 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 216
Target Start/End: Complemental strand, 23332800 - 23332595
Alignment:
| Q |
11 |
tgagatgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagagagatcagga |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332800 |
tgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagagagatcagga |
23332701 |
T |
|
| Q |
111 |
gtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaccgtgaggatggatcggtcatgcgcttctatcgctcattcgtcc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332700 |
gtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctcattcgtcc |
23332601 |
T |
|
| Q |
211 |
acatat |
216 |
Q |
| |
|
| |||| |
|
|
| T |
23332600 |
atatat |
23332595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 211 - 249
Target Start/End: Complemental strand, 23322373 - 23322335
Alignment:
| Q |
211 |
acatatgcgtttggattttacaacgattgtgtttggtga |
249 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtga |
23322335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 211 - 249
Target Start/End: Complemental strand, 23332540 - 23332502
Alignment:
| Q |
211 |
acatatgcgtttggattttacaacgattgtgtttggtga |
249 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtga |
23332502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University