View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_144 (Length: 249)
Name: NF11180A_low_144
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_144 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 21 - 231
Target Start/End: Original strand, 55341744 - 55341954
Alignment:
| Q |
21 |
catcttcgatgagatgagaaaagcacctgagatggatttccaagcaagacttgccatgcttggcgcagcnnnnnnnnnnnnntaagctggccttagcact |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
55341744 |
catcttcgatgagatgagaaaagcacctgagatggatttccaagcaagacttgccatgcttggtgcagcaaaaaacaaaaaataagctggccttagcact |
55341843 |
T |
|
| Q |
121 |
acaggaaactgattactacttgttagacgctgatacagcgtcacaaatagaatcaaataatgtaccattcctaatgaatacattgaaattgcaatctcgt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55341844 |
acaggaaactgattactacttgttagacgctgatacagcgtcacaaatagaatcaaataatgtaccattcctaatgaatacattgaaattgcaatctcgt |
55341943 |
T |
|
| Q |
221 |
tccaaccaatt |
231 |
Q |
| |
|
||||||||||| |
|
|
| T |
55341944 |
tccaaccaatt |
55341954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University