View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_160 (Length: 244)
Name: NF11180A_low_160
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_160 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 12 - 236
Target Start/End: Complemental strand, 5726603 - 5726366
Alignment:
| Q |
12 |
atagtagactggaaaaagcgtttctttaatttaattaagatattaacatatgccgacataatgaagcataaaatttagagttaatttttgcacccttaac |
111 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5726603 |
atagtagactgaaaaaagcatttctttaatttaattaagatattaacatatgccgacataatgaagcataaaatttagagttaatttttgcaaccttaac |
5726504 |
T |
|
| Q |
112 |
ttcttagtttttccttagcaaacaaataatgt--------------ctcgtagagattccttttgagttaattgatatcattttatgatattgacatatt |
197 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5726503 |
ttcttagtttttccttagc-aacaaataatgtaacatctacgagcaattgcagagattccttttgagttaattgatatcattttatgatattgacatatt |
5726405 |
T |
|
| Q |
198 |
cgggtatatatttttcatatgcacaggtttaaattgaaa |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5726404 |
cgggtatatatttttcatatgcacaggtttaaattgaaa |
5726366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University