View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_161 (Length: 243)
Name: NF11180A_low_161
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_161 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 35 - 217
Target Start/End: Original strand, 40225398 - 40225580
Alignment:
| Q |
35 |
ctatagcaccaaatatataagtggaggaaaaaattacttacaaaaattgaccaagaacgtgggcgtaacgtaaggtttgagtttaatgagagaatgatgg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40225398 |
ctatagcaccaaatatataagtggaggaaaaaattacttacaaaaattgaccaagaacgtgggcgtaacgtaaggtttgagtttaatgagagaatgatgg |
40225497 |
T |
|
| Q |
135 |
tgaaaagacaaagctatttcttaaccaagcttcaatgaatttttgtaatggaagaagggaacagagatgaaaggataagggta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40225498 |
tgaaaagacaaagctatttcttaaccaagcttcaatgaatttttgtaatggaagaagggaacagagatgaaaggataagggta |
40225580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University