View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11180A_low_161 (Length: 243)

Name: NF11180A_low_161
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11180A_low_161
NF11180A_low_161
[»] chr7 (1 HSPs)
chr7 (35-217)||(40225398-40225580)


Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 35 - 217
Target Start/End: Original strand, 40225398 - 40225580
Alignment:
35 ctatagcaccaaatatataagtggaggaaaaaattacttacaaaaattgaccaagaacgtgggcgtaacgtaaggtttgagtttaatgagagaatgatgg 134  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40225398 ctatagcaccaaatatataagtggaggaaaaaattacttacaaaaattgaccaagaacgtgggcgtaacgtaaggtttgagtttaatgagagaatgatgg 40225497  T
135 tgaaaagacaaagctatttcttaaccaagcttcaatgaatttttgtaatggaagaagggaacagagatgaaaggataagggta 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40225498 tgaaaagacaaagctatttcttaaccaagcttcaatgaatttttgtaatggaagaagggaacagagatgaaaggataagggta 40225580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University