View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_177 (Length: 236)
Name: NF11180A_low_177
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_177 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 32883008 - 32883212
Alignment:
| Q |
1 |
tataaaaaccatttttggtggggatcccgttttgtcatgtaatgccaaaattatgccatgtaacaattctggctccttttccaatactccccagagccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32883008 |
tataaaaaccatttttggtggggatcccgttttgtcatgtaatgccaaaattatgccatgtaacaattctggctccttttccaatactccccagagccca |
32883107 |
T |
|
| Q |
101 |
tgccccagaggcacaagcaaccctgttgaaggattatgtgtcttgcaacatgctaatttgaattcgcaagaagtttatcagaattactatgtgtcatcat |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32883108 |
tgccccagaggcataagcaaccctgttgaaggattatgtgtcttgcaacatgctaatttgaattcgcaagaagtttatcagaattactatgtgtcatcat |
32883207 |
T |
|
| Q |
201 |
gattt |
205 |
Q |
| |
|
||||| |
|
|
| T |
32883208 |
gattt |
32883212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University