View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_187 (Length: 231)
Name: NF11180A_low_187
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_187 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 43239060 - 43238834
Alignment:
| Q |
1 |
aacataaaagttaaaacataatttaactgagaata-gagtaatatacctttgtcaatagtatgagcagtggaaagatcataagaatcatttgagatattc |
99 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43239060 |
aacataaaagttaaaacataatttagctgagaataagagtaatatacctttgtcaatagtatgagcagtggaaaggtcataagaatcatttgagatattc |
43238961 |
T |
 |
| Q |
100 |
ttgtcttcttgaccatgttctaggttgagagtgagagagttatcattgcttgctctaccttcaacctccatggtgaatatgttaactcattccaatttcc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43238960 |
ttgtcttcttgaccatgttctaggttgagagtgagagagttatcattgcttgctctaccttcaacctccatggtgaatatgttaactcattccaatttcc |
43238861 |
T |
 |
| Q |
200 |
aaaaacgcaaga-tttggtacacatat |
225 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
43238860 |
aaaaacgcaagagtttggtacacatat |
43238834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University