View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_191 (Length: 231)
Name: NF11180A_low_191
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_191 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 48 - 208
Target Start/End: Complemental strand, 28587083 - 28586923
Alignment:
| Q |
48 |
tgggaacatatggtaaacgtttaccttttcttgttaacttttctattttatataatatgattggatttagtgaaatgatagtatgagtgtatgacaccat |
147 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28587083 |
tgggaacatatggtaaacgtttacctattcttgttaacttttctattttataaaatatgattggatttagtgaaatgatagtatgagtgtatgacaccat |
28586984 |
T |
 |
| Q |
148 |
tagctttaatctactcatatattttaccaatctccccatatattctgtatccatatatatt |
208 |
Q |
| |
|
|| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28586983 |
taactttaatctactgatatattttaccaatctccccatatattctgtatccatatatatt |
28586923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University