View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_193 (Length: 230)
Name: NF11180A_low_193
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_193 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 12 - 225
Target Start/End: Complemental strand, 25399728 - 25399523
Alignment:
| Q |
12 |
gtcacaaccaacatttgtttttggagaagtacttcatctttagatgggaaataattaatctatttgagaggatttataaattatgatatatatttgtgan |
111 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25399728 |
gtcacaaccaacatctgtttttggagaagtatttcatctttagatgggaaataattaatctatttgagaggatttataaattatgatatatatttgtgat |
25399629 |
T |
|
| Q |
112 |
nnnnnnattaaacacctaaacatgatatgtattttttgagggaaaacatgataactatttttaatattttctttggagaactagagtgaaccgacaagtt |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25399628 |
ttttttattaaaca--------tgatatgtattttttgagggaaaacatgataactatttttaatattttctttggagaactagagtgaaccgacaagtt |
25399537 |
T |
|
| Q |
212 |
tgcactaagtaaat |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25399536 |
tgcactaagtaaat |
25399523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University