View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_204 (Length: 227)
Name: NF11180A_low_204
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_204 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 22 - 220
Target Start/End: Original strand, 26955221 - 26955419
Alignment:
| Q |
22 |
tcatcaacgtctaagaaacaagatcaaaactattcacgacactccaatcttgcaaggtgcgtgtttgatcagctggtagtgcataattctttcactattt |
121 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26955221 |
tcatcaacatctaagaaacaagatcaaaactattctcgacactccaatcttgcaaggggcgtgtttgatcagctggtagtgcataattctttcactattt |
26955320 |
T |
|
| Q |
122 |
attatcataattatcacacggttattttgtagtgattaagtactattaagagcttcgatctatgagttctctcaccaagttatatatttttcgacatcc |
220 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
26955321 |
attatcataattatcacacggttatattgtagtaattaagagctattaagagcttcgatctatgagttctctcaccaagttatatattattcaacatcc |
26955419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University