View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_217 (Length: 220)
Name: NF11180A_low_217
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_217 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 22 - 203
Target Start/End: Original strand, 12065099 - 12065279
Alignment:
| Q |
22 |
tggccgcgtcaggatgtttgatattgcagagaattgtggtcaaatgcagccgatgcagacaaaattcaagaagaaagttgtcaacaaggttttaaaacgt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12065099 |
tggccgcgtcaggatgtttgatattgcagagaatcgtggtcaa-tgcagccgatgcagacaaaattcaagaagaaagttgtcaacaaggttttaaaacgt |
12065197 |
T |
|
| Q |
122 |
ggtcacgccacgatctttgatattgcagagaatcgtggtcagatgaagttgatgttctgaggctgatgtggcgtcaattgtg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
12065198 |
ggtcacgccacgatctttgatattgcagagaatcgtggtcagatgaagttgatgttatgaggctgctgtggcgtcaattgtg |
12065279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 67
Target Start/End: Complemental strand, 18363485 - 18363457
Alignment:
| Q |
39 |
ttgatattgcagagaattgtggtcaaatg |
67 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18363485 |
ttgatattgcagagaattgtggtcaaatg |
18363457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University