View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_226 (Length: 210)
Name: NF11180A_low_226
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_226 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 3 - 78
Target Start/End: Complemental strand, 50422861 - 50422786
Alignment:
| Q |
3 |
gtgttcgaacaaaattttatgatctagcgannnnnnnataagctaaaaataagcatatatagaagagactaatggt |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50422861 |
gtgttcgaacaaaattttatgatctagcgatttttttataagctaaaaataagcatatatagaagagactaatggt |
50422786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University