View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_233 (Length: 203)
Name: NF11180A_low_233
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_233 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 23 - 184
Target Start/End: Complemental strand, 3006720 - 3006558
Alignment:
| Q |
23 |
tgaacaacttaatctagtagggctattctgatggtgaccagtgtggagataaaattgataggaggagcacaattagttatgtgcttaaggtacaaggaga |
122 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3006720 |
tgaacaacttaatctagtaggactattctgatggtgactagtgtggagataaaattgataggaggagcacaattagttatgtgtttaaggtacaaggaga |
3006621 |
T |
 |
| Q |
123 |
tcgtatctcatggccatataagaagcaattaatggtttc-tttatcaagttatgaagaataat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3006620 |
tcgtatctcatggccatataagaagcaattaatggtttcttttatcaagttatgaagaataat |
3006558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University