View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_6 (Length: 469)
Name: NF11180A_low_6
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 435; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 435; E-Value: 0
Query Start/End: Original strand, 11 - 465
Target Start/End: Original strand, 42484606 - 42485060
Alignment:
| Q |
11 |
agaatatatagattgagggacacgtggcagttagagtacatctactggcatcgaacggctaggaactttaccacaggtagacatgctttagtggtcccac |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42484606 |
agaacatatagattgagggacacgtggcagttagagtacatctactggcatcgaacggctaggaactttaccacaggtagacatgctttagtggtcccac |
42484705 |
T |
 |
| Q |
111 |
aatatgatccaggagatcaccaccaaaacctcatctgccgctgcctcactctctccgacacccacctcgcctgtggcttcgtcgacggtagtgtccgact |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42484706 |
aatatgatccaggagatcaccaccaaaacctcatctgccgctgcctcactctctccgacacccaccttgcctgtggcttcgtcgacggtagtgtccgact |
42484805 |
T |
 |
| Q |
211 |
cttcgatctccacaccggtgcacatgttagcacattttggtccaaccatggtcttctatttggcccgttctcacaatccgtttcgggaattttaattgga |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
42484806 |
cttcgatctccacaccggtgcacatgttagcacattttggtccaaccatggtcttctatttggcccgttctcacaatccgtttcaggaattgtaattgga |
42484905 |
T |
 |
| Q |
311 |
agctctactctcgccttcgcaagattagatggagatgtctacattgctattataaatgggcctggaccaatacccgggcccattcctgcacgacgggcaa |
410 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42484906 |
agctctactctcgccttcgcgagattagatggagatgtctacattgctattataaatgggcctggaccaatacccgggcccattcctgcacgacgggcaa |
42485005 |
T |
 |
| Q |
411 |
ttattggtgatgttgttaataacggagtattagtagaatttgccggctctagtcg |
465 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42485006 |
ttattggtgatgttgttaataacggagtattagtagaatttgccggctctagtcg |
42485060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University