View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_61 (Length: 327)
Name: NF11180A_low_61
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_61 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 7 - 314
Target Start/End: Complemental strand, 6236647 - 6236342
Alignment:
| Q |
7 |
ctcaccacccagctttattgcttcttttctctctagagagggttcgggacttccttattataggattttgatgtaattctgccttttctgtttttgtttc |
106 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6236647 |
ctcaccaccctgctttattgcttcttttctctctagagagggttcaggacttccttattataggattttgatgtaattctgccttttctatttttgtttc |
6236548 |
T |
|
| Q |
107 |
ttcctgatgtagaccttgttatgggttctggccctctctagttttattgaatttcttcgcttgatcnnnnnnnnnnnnnnttagattttcacctatcacc |
206 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6236547 |
ttcctgatgtagactttgttatgggttctggccctcttcagttttattgaatttcttcgcttgat--aaaaaaaaaaaaattagattttcacctatcacc |
6236450 |
T |
|
| Q |
207 |
taggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtgggaacactataatttagaaacac |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6236449 |
taggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtgggaacactaaaatttagaaacac |
6236350 |
T |
|
| Q |
307 |
catgatat |
314 |
Q |
| |
|
|||||||| |
|
|
| T |
6236349 |
catgatat |
6236342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 187 - 292
Target Start/End: Original strand, 33891807 - 33891908
Alignment:
| Q |
187 |
ttagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtggga |
286 |
Q |
| |
|
||||||||||||| || | |||||||||||||| ||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33891807 |
ttagattttcacccataaactaggttttcaatta----taactaaagtgaaaagggaaatatggtttctaggacttcttttacttttgttgaatgtgggg |
33891902 |
T |
|
| Q |
287 |
acacta |
292 |
Q |
| |
|
|||||| |
|
|
| T |
33891903 |
acacta |
33891908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 187 - 292
Target Start/End: Complemental strand, 33952441 - 33952340
Alignment:
| Q |
187 |
ttagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtggga |
286 |
Q |
| |
|
||||||||||||| || | |||||||||||||| ||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33952441 |
ttagattttcacccataaactaggttttcaatta----taactaaagtgaaaagggaaatatggtttctaggacttcttttacttttgttgaatgtgggg |
33952346 |
T |
|
| Q |
287 |
acacta |
292 |
Q |
| |
|
|||||| |
|
|
| T |
33952345 |
acacta |
33952340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University