View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_70 (Length: 304)
Name: NF11180A_low_70
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_70 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 8 - 304
Target Start/End: Original strand, 38737399 - 38737704
Alignment:
| Q |
8 |
ggctggtgacaaaagctagaaagcttacttggggaaggggtggttttcggagtaacacaagatatggcagtggtggtggtagcaacggcaagagttcccg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38737399 |
ggctggtgacaaaagctagaaagcttacttggggaaggggtggttttcggagtaacacaagatatggcagtggtggtggtagcaacggcaagagttcccg |
38737498 |
T |
|
| Q |
108 |
tagtggtcgaatgtctaggttggttgattatctcaaaaacttgaatgagaacactgatgaggtataagttc---------nnnnnnnnctctctctcttg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38737499 |
tagtggtcgaatgtctaggttggttgattatctcaaaaacttgaatgagaacactgatgaggtataagttctttttttttttttttctctctctctcttg |
38737598 |
T |
|
| Q |
199 |
taatggaccaatgaaaaatgatactacgtattgcttctttattatacttgtattcttatttcagttcaatttaacaaatagataccgtcttttatttaca |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38737599 |
taatggaccaatgaaaaatgatactacgtattgcttctttattatacttgtattcttatttcagttcaatttaacaaatagatactgtcttttatttaca |
38737698 |
T |
|
| Q |
299 |
gtttga |
304 |
Q |
| |
|
|||||| |
|
|
| T |
38737699 |
gtttga |
38737704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University