View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_77 (Length: 294)
Name: NF11180A_low_77
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_77 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 13 - 294
Target Start/End: Complemental strand, 33102771 - 33102490
Alignment:
| Q |
13 |
gttggcgcagggttctcttcgaagtttgacggtcttggagtcggcccacgggaattggactgaacggaatacacatcattagcaccaaaattagaatgtc |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33102771 |
gttggcacagggttctcttcgaagtttgacggtcttggagtcggcccacgggaattggactgaacggaatacacatcattagcaccaaaattagaatgtc |
33102672 |
T |
 |
| Q |
113 |
tcggagcatagcccatcatagagtagaaatccgtatgattaaaattagaccctcgcggcgtcggattccgggaagaactcaaactataaatctctgctcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33102671 |
tcggagcatagcccatcatagagtagaaatccgtatgattaaaattagaccctcgcggcgtcggattccgggaagaactcaaactataaatctctgctcc |
33102572 |
T |
 |
| Q |
213 |
ggtgagattcgacggccgcggagtcatcataaaagatctccgggaagcgtttgattttctgacatgaacatgaagcttacca |
294 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33102571 |
ggtgagattcgacggccgtggagtcatcataaaagatctccgggaagcgtttgattttctgacatgaacatgaagcttacca |
33102490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University