View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_78 (Length: 294)
Name: NF11180A_low_78
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 31442088 - 31441811
Alignment:
| Q |
1 |
gatttaccgcaaccactgtgtcttgctagtgccaccgtttttccagcctcaactttgagattcaaaccctggaatacaatttgctcagttctagagggat |
100 |
Q |
| |
|
|||||||||||||||||||| | | | |||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
31442088 |
gatttaccgcaaccactgtgccctacaagtgccaccgttcgtccagcctcaactttgagattcaaaccctggaataccatttgctcaggtctagagggat |
31441989 |
T |
 |
| Q |
101 |
aagcaaagaatacatttttaagctccaccctgccccttattttccnnnnnnn-atctgctccccataaggtttcaggatcaatctcacttttcctgtcta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31441988 |
aagcaaagaatacatttttaagctccaccctgccccttattttccttttttttatctgctccccataaggtttcaggatcaatctcacttttcctgtcta |
31441889 |
T |
 |
| Q |
200 |
ggatagcgaaaactgatccaactgcattgcttcctttagatatgtcagaagtcatgcttccagcttctgcaatgatgt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31441888 |
ggatagcgaaaactgatccaactgcattgcttcctttagatatgtcagaagtcatgcttccagcttctgcaatgatgt |
31441811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University