View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_93 (Length: 281)
Name: NF11180A_low_93
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_93 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 37546835 - 37546566
Alignment:
| Q |
1 |
tcattgccttactccgcccgcgagaagggctgaaatattatttttgacgcattaaaa-gcaaactcatatgggaagtagatatacaagccttcaaaatct |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37546835 |
tcattgccttactccgcccgcgagaagggctgaaatattatttttgacgcattaaaaagcaaactcatatgggaagtagatatacaagccttcaaaatct |
37546736 |
T |
|
| Q |
100 |
caatataatcacctattatcaccaaactcagcctcatgctaagtgtctaatagagaacccaccttactcgatcatagtaggttttctctatatccacttt |
199 |
Q |
| |
|
||||||| | || |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37546735 |
caatatagtagg---ttttcaccaaactcagcctcatgctgagtgtctaatagaaaacccaccttactcgatcatagtaggttttctctatatccacttt |
37546639 |
T |
|
| Q |
200 |
gatagcaacatacctctttgataacccacaaatatgttcgttaatacctttacttttttccctaaatattctt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37546638 |
gatagcaacatacctctttgataacccacaaatatgttggttaatacctttacttttttccctaaatattctt |
37546566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University