View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_97 (Length: 276)
Name: NF11180A_low_97
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_97 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 9 - 276
Target Start/End: Original strand, 31441567 - 31441834
Alignment:
| Q |
9 |
agaaccataactgcattcagttctcagaaaagaatgttggcactcttcaaagctacaatgacaggacctaaacaggagagtattaggcagtcatggattt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31441567 |
agaaccataactgcattcagttctcagaaaagaatgttggcactcttcaaagctacaatgacaggacctaaacaggagagtattaggcagtcatggattt |
31441666 |
T |
 |
| Q |
109 |
caggttttggtcttttcagctcacaatttttcaacacttcatcaacagcattggcatattggtatggtgggagtctcctaataaaaggccaaatagaacc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31441667 |
caggttttggtcttttcagctcacaatttttcaacacttcatcaacagcattggcatattggtatggtgggagtctcctaataaaaggccaaatagaacc |
31441766 |
T |
 |
| Q |
209 |
gacggaactcttccaagcatttttaatattgctcttcactgcatacatccttgcagaagctggaagca |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31441767 |
gacggaactcttccaagcatttttaatattgctcttcactgcatacatcattgcagaagctggaagca |
31441834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University