View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180_high_10 (Length: 266)
Name: NF11180_high_10
Description: NF11180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 34 - 249
Target Start/End: Complemental strand, 33221624 - 33221409
Alignment:
| Q |
34 |
tacaagatacttcttcacttcacacacaacacaaccctcgccgaatgaaagtagcgtgaatcatgtgtcccaaataagtggaaaagacattgatgtcctt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33221624 |
tacaagatacttcttcacttcacacacaacacaaccctcgccgaatgaaagtagcgtgaatcatgtgtctcaaataagtggaaaagacattgatgtcctt |
33221525 |
T |
 |
| Q |
134 |
aaaacctcgtacgtgtcagtgtatctttgttttcactctcaacaacttaagtggggccatataagggtattcaaggtaacattgcagtgtgtctataaaa |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
33221524 |
aaaacctcgtacgtgtcagtgtatctttgttttcactctcaacaacttaagtggggccatataagggtattcgaggtaacattgtagtgtgtctataaat |
33221425 |
T |
 |
| Q |
234 |
ttcacatccctttcat |
249 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
33221424 |
ttcacatccctttcat |
33221409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University