View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180_high_4 (Length: 366)
Name: NF11180_high_4
Description: NF11180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 18 - 357
Target Start/End: Original strand, 9379664 - 9380003
Alignment:
| Q |
18 |
gatgacacaagcataaaagttgaatactttggtttagaagatgaaactggtcttatgaattttgctgaacatgctgatggttctttaacatcaccagaag |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379664 |
gatgacacaagcataaaggttgaatactttggtttagaagatgaaactggtcttatgaattttgctgaacatgctgatggttctttaacatcaccagaag |
9379763 |
T |
|
| Q |
118 |
attggagtgcttttgaatcaaatgatttattaggccaatcaagttgtgattatcaatggtgggacttttggtcttgaatgaaacagaggaggaaaatatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379764 |
attggagtgcttttgaatcaaatgatttattaggccaatcaagttgtgattatcaatggtgggacttttggtcttgaatgaaacagaggaggaaaatatg |
9379863 |
T |
|
| Q |
218 |
tgtggaggaaatatatgcaaaatttatgatgttagaatcatcattgttttgttgaagaagttgtcagaggaaaatcaagggacattttgttttttgtaca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379864 |
tgtggaggaaatatatgcaaaatttatgatgttagaatcatcattgttttgttgaagaagttgtcagaggaaaatcaagggacattttgttttttgtaca |
9379963 |
T |
|
| Q |
318 |
acataatcattagtttgtaggaaatgattttcatctctgc |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379964 |
acataatcattagtttgtaggaaatgattttcatctctgc |
9380003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University