View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180_low_7 (Length: 320)
Name: NF11180_low_7
Description: NF11180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 14 - 301
Target Start/End: Complemental strand, 12638760 - 12638478
Alignment:
| Q |
14 |
gaacatacttatcagaaaatataatataatatatgagcacggtcctcgagttcagctactgttgctaaccattgtttaaaattatcattatcgattaata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||||||||||| |
|
|
| T |
12638760 |
gaacatacttatcagaaaatataatata-----tgagcacggtcctcgagttcagctactgttgctgaccattgttcaaaactatcattatcgattaata |
12638666 |
T |
 |
| Q |
114 |
gcactataatacacttatacacgttactagtttgttttatcaccaaatcattcacctatagcttaaaaattgctgatagctactagcactaaactacaca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12638665 |
gcactataatacacttatacacgttactagtttgttttatcaccaaatcattcacctatagcttaaaaattgctgatagctactagcactaaactacaca |
12638566 |
T |
 |
| Q |
214 |
tttctagttggtttaacctccatggattccccaattttttacttactagcccttgtcttctttttcatcttcatgcttgtggtactta |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12638565 |
tttctagttggtttaacctccatggattccccaattttttacttactagcccttgtcttgtttttcatcttcatgcttgtggtactta |
12638478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University