View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11181_high_6 (Length: 217)
Name: NF11181_high_6
Description: NF11181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11181_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 32143066 - 32142884
Alignment:
| Q |
15 |
gaaacaactacaacctcgaatgatcatgatgaagaaaccctaatgaattctcaaagcaatagctttgaaagaaacttcaaagagtgtagaaagaatcacg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32143066 |
gaaacaactacaacctcgaatgatcatgttgaagaaaccctaatgaattctcaaagcaatagctttgaaagaaacttcaaagagtgtagaaagaatcacg |
32142967 |
T |
|
| Q |
115 |
cttccagcattggaggctacgctcttgatggttgtggcgagtttttacccgctggaattgaaggaaccatcgaatttttcaca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32142966 |
cttccagcattggaggctacgctcttgatggttgtggcgagtttttacccgctggaattgaaggaaccatcgaatttttcaca |
32142884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 28905963 - 28905783
Alignment:
| Q |
15 |
gaaacaactacaacctcgaatgatcatgatgaagaaaccctaatgaattctcaaagcaatagctttgaaagaaacttcaaagagtgtagaaagaatcacg |
114 |
Q |
| |
|
|||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||||||||| | |
|
|
| T |
28905963 |
gaaacaactaaaaccttgaatcatcatgatgaagaaaccctaatgaattctcaaagcaatagcttcgaagaaaagttcaaagagtgtagaaagaatcatg |
28905864 |
T |
|
| Q |
115 |
cttccagcattggaggctacgctcttgatggttgtggcgagtttttacccgctggaattgaaggaaccatcgaatttttca |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28905863 |
cttccagcattggaggctacgctcttgatggttgtggcgagtttttacccgctggaattgaagggaccatcgaatttttca |
28905783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 116 - 170
Target Start/End: Original strand, 15978475 - 15978529
Alignment:
| Q |
116 |
ttccagcattggaggctacgctcttgatggttgtggcgagtttttacccgctgga |
170 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| | ||||||||||| |||||| |
|
|
| T |
15978475 |
ttccagtattggaggctactctcttgatggttgtcgtgagtttttacctgctgga |
15978529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University