View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11181_low_6 (Length: 264)
Name: NF11181_low_6
Description: NF11181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11181_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 22 - 162
Target Start/End: Complemental strand, 8176947 - 8176807
Alignment:
| Q |
22 |
tttagttgtatttggtgttataggaatatcagttttaagttttaaaataaattgcacctctttataaatgagagagatcatttgattttcttttcaattc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8176947 |
tttagttgtatttggtgttataggaatatcagttttaagttttaaaataaattgcacctctttataaatgagagagatcattcgattttcttttcaattc |
8176848 |
T |
|
| Q |
122 |
tagcgagtttgtcttcacacttatgagttgttgagtaatct |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8176847 |
tagcgagtttgtcttcacacttatgagttgttgagtaatct |
8176807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 163 - 250
Target Start/End: Complemental strand, 8176701 - 8176614
Alignment:
| Q |
163 |
tagagttagcactaagacgctcaagttaataaaatgaggaaggaaagtgtgcgaaaagtggtgaaaatgtcatcgtatctcaagtgtg |
250 |
Q |
| |
|
||||||||||| ||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8176701 |
tagagttagcattaagatgctcaagttaatgaaatgaggaaggaaagtgtgcgaaaagtggtgaaaatgtcatcgtacctcaagtgtg |
8176614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 194 - 231
Target Start/End: Original strand, 45046467 - 45046504
Alignment:
| Q |
194 |
aaatgaggaaggaaagtgtgcgaaaagtggtgaaaatg |
231 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
45046467 |
aaatgaggaaggaaaatgtgcgaaaagtgatgaaaatg |
45046504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 194 - 239
Target Start/End: Complemental strand, 16687719 - 16687675
Alignment:
| Q |
194 |
aaatgaggaaggaaagtgtgcgaaaagtggtgaaaatgtcatcgta |
239 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16687719 |
aaatgagga-ggaaagtgtgcgaaaagtggtgaaattgtcatcgta |
16687675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University