View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11182_high_2 (Length: 389)
Name: NF11182_high_2
Description: NF11182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11182_high_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 26 - 250
Target Start/End: Complemental strand, 33757206 - 33756982
Alignment:
| Q |
26 |
atcatgaagagagtgaaagcattaaaagtggttcgaattggtgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgagga |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33757206 |
atcatgaagagagtgaaagcattaaaagtggttcgaattggtgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgagga |
33757107 |
T |
|
| Q |
126 |
gtcgtatcgttgaaggatcgagtggtggctgtgattgtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33757106 |
gtcgtatcgttgaaggatcgagtggtggttgtgattgtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctc |
33757007 |
T |
|
| Q |
226 |
cgtcgccataactaactttcacggc |
250 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
33757006 |
cgtcgccataacaaactttcacggc |
33756982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University