View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11183_high_27 (Length: 308)
Name: NF11183_high_27
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11183_high_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 12 - 244
Target Start/End: Complemental strand, 5831620 - 5831399
Alignment:
| Q |
12 |
atgaattacaaaacccatgtaatacaagacttactttcaatgtgatgtgagttacaatagaggaatcaaatatgaccctctccaccaataggtgaatatg |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5831620 |
atgagttacaaaacccatgtaatacaagacttactttcaatgtgatgtgagttacaatagaggaatcaaatacgaccctctccaccaataggtgaatatg |
5831521 |
T |
|
| Q |
112 |
tgatgttttgtccccttcctaattggtatatattattttatactgcaaacatggagtgctatagaaaagttcccttgcgctttttgccatcgtggaagtg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5831520 |
tgatgttttgtccccttcctaattggtatatattattttatactgcaaacat-----------gaaaagttcccttgcgctttttgccatcgtggaagtg |
5831432 |
T |
|
| Q |
212 |
aatctatggcagagtcatccatgacgatgattt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5831431 |
aatctatggcagagtcatccatgacgatgattt |
5831399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University