View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11183_high_34 (Length: 253)
Name: NF11183_high_34
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11183_high_34 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 8 - 253
Target Start/End: Original strand, 38977265 - 38977510
Alignment:
| Q |
8 |
gagaagaatttcaatggcggatggaatatcataaaccggagcacgagcttgcagaagaccctcgtgcatgaaaaacaatgaatccgcggcctgagtaaaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38977265 |
gagaagaatttcaatggcggatggaatatcataaaccggagcacgggcttgcagaagaccctcgtgcatgaaaaacaatgaatccgcggcctgagtaaaa |
38977364 |
T |
|
| Q |
108 |
cacatgtcgtgattggaaactgtggaagacaattgctgacaatgctgtatcaatggaagctgttgacaccatttggataggacattgagacggatcatac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38977365 |
cacatgtcgtgattggaaactgtggaagacaattgctgacaatgctgtatcaatggaagctgttgacaccatttggataggacattgagacggatcatac |
38977464 |
T |
|
| Q |
208 |
gttgccgagtcttggtgagaaatttgagcatgctaatcttcttatc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38977465 |
gttgccgagtcttggtgagaaatttgagcatgctaatcttcttatc |
38977510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 8 - 165
Target Start/End: Original strand, 47569579 - 47569736
Alignment:
| Q |
8 |
gagaagaatttcaatggcggatggaatatcataaaccggagcacgagcttgcagaagaccctcgtgcatgaaaaacaatgaatccgcggcctgagtaaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||| |||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
47569579 |
gagaagaatttcaatggcggatggaacatcataaaccggagcccgagcttgctgaagcccctcgtgcatgaaaaacaacgaatccgcagcctgagtaaaa |
47569678 |
T |
|
| Q |
108 |
cacatgtcgtgattggaaactgtggaagacaattgctgacaatgctgtatcaatggaa |
165 |
Q |
| |
|
|||||||||||||| ||||| || ||||||| ||||||||| ||||||||||| |||| |
|
|
| T |
47569679 |
cacatgtcgtgattcgaaacagttgaagacagttgctgacagtgctgtatcaaaggaa |
47569736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 167 - 253
Target Start/End: Original strand, 47570051 - 47570137
Alignment:
| Q |
167 |
ctgttgacaccatttggataggacattgagacggatcatacgttgccgagtcttggtgagaaatttgagcatgctaatcttcttatc |
253 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47570051 |
ctgttggcaccatttggagaggacattgagacggatcatacgttgctgagtcttggtaagaaatttgagcatgctaatcttcttatc |
47570137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University