View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11183_high_36 (Length: 250)
Name: NF11183_high_36
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11183_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 4 - 245
Target Start/End: Complemental strand, 42661733 - 42661492
Alignment:
| Q |
4 |
atgtttcattggtaatttttagacagacactaacggaaaattatgaatttcagagccatgcatggatgacagaatctgagaaggaacaaatctgcaggct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42661733 |
atgtttcattggtaatttttagacagacactaacggaaaattatgaatttcagagccatgcatggatgacagaatctgagaaggaacaaatctgcaggct |
42661634 |
T |
 |
| Q |
104 |
gatgaattgccagaaactctcattggaagcaagcacacacgcagctcaaaacgaaaggctaccacttcgtgttgttgtccaagttttgttcttcgaacaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42661633 |
gatgaattgccagaaactctcattggaagcaagcacacacgcagctcaaaacgaaaggctaccacttcgtgttgttgtccaagttttgttcttcgaacaa |
42661534 |
T |
 |
| Q |
204 |
ctcaagctacgcacatctgttgcaggttggttctctgcttct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42661533 |
ctcaagctacgcacatctgttgcaggttggttctttgcttct |
42661492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University