View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11183_high_37 (Length: 250)

Name: NF11183_high_37
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11183_high_37
NF11183_high_37
[»] chr5 (1 HSPs)
chr5 (12-250)||(14201086-14201324)


Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 14201086 - 14201324
Alignment:
12 atgaaggctttgatctttaactgtgattgtggtgatgcagtacgatcatattcttcgattagattgatgagatcttcgtcggaggtgatggaaaccaaag 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14201086 atgaaggctttgatctttaactgtgattgtggtgatgcagtacgatcatattcttcgattagattgatgagatcttcgtcggaggtgatggaaaccaaag 14201185  T
112 cgtcgaggtcttcagcgggtaactgacagcgaagttgcgttacggatgaactgcagagctctttcagcttcaataacagttctgtaacaaaaacagcttc 211  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14201186 cgtcgaggtcttcagcaggtaactgacagcgaagttgcgttacggatgaactgcagagctctttcagcttcaataacagttctgtaacaaaaacagcttc 14201285  T
212 aaaatcaatttcaaattgaactaattattgtaactaact 250  Q
    |||||||||||||||||||||||||||||||||||||||    
14201286 aaaatcaatttcaaattgaactaattattgtaactaact 14201324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University