View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11183_high_37 (Length: 250)
Name: NF11183_high_37
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11183_high_37 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 14201086 - 14201324
Alignment:
| Q |
12 |
atgaaggctttgatctttaactgtgattgtggtgatgcagtacgatcatattcttcgattagattgatgagatcttcgtcggaggtgatggaaaccaaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14201086 |
atgaaggctttgatctttaactgtgattgtggtgatgcagtacgatcatattcttcgattagattgatgagatcttcgtcggaggtgatggaaaccaaag |
14201185 |
T |
 |
| Q |
112 |
cgtcgaggtcttcagcgggtaactgacagcgaagttgcgttacggatgaactgcagagctctttcagcttcaataacagttctgtaacaaaaacagcttc |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14201186 |
cgtcgaggtcttcagcaggtaactgacagcgaagttgcgttacggatgaactgcagagctctttcagcttcaataacagttctgtaacaaaaacagcttc |
14201285 |
T |
 |
| Q |
212 |
aaaatcaatttcaaattgaactaattattgtaactaact |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14201286 |
aaaatcaatttcaaattgaactaattattgtaactaact |
14201324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University