View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11183_high_49 (Length: 236)
Name: NF11183_high_49
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11183_high_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 99 - 223
Target Start/End: Complemental strand, 44615560 - 44615436
Alignment:
| Q |
99 |
gatgtaggagttattgctgctacgtttgtgtgtcctttagatgttatcaaaactaggtttcaagttggtgttccccagctcgctaatggaactgttaaag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44615560 |
gatgtaggagttattgctgctacgtttgtgtgtcctttagatgttatcaaaactaggtttcaagttggtgttccccagctcgctaatggaactgttaaag |
44615461 |
T |
|
| Q |
199 |
gtaccatataacctgcccactcttc |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44615460 |
gtaccatataacctgcccactcttc |
44615436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 44615679 - 44615643
Alignment:
| Q |
1 |
gtgcttccgctggtataccttcttttctcagctgccc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44615679 |
gtgcttccgctggtataccttcttttctcagctgccc |
44615643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 39314798 - 39314859
Alignment:
| Q |
99 |
gatgtaggagttattgctgctacgtttgtgtgtcctttagatgttatcaaaactaggtttca |
160 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| || ||||| |||||||| |
|
|
| T |
39314798 |
gatgcaggagttattgctgctacgtttgtgtgtcctttagatgtgattaaaaccaggtttca |
39314859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University