View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11183_high_53 (Length: 226)
Name: NF11183_high_53
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11183_high_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 211
Target Start/End: Complemental strand, 27632354 - 27632158
Alignment:
| Q |
15 |
caaaggaaagctctatagacagttgtcccttatcagattggggaatgagaaactcaccttatcatgaaagtagaatatcagattggatagaagaattgca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27632354 |
caaaggaaagctctatagacagttgtcccttatcagattggggaatgagaaactcaccttatcatgaaagtagaatatcagattggatagaagaattgca |
27632255 |
T |
|
| Q |
115 |
aaatggatttggtgataaggaaaaggaattaggacaagattttaatagtataaatggatcaatatatgattataatccccagcaagaatatgatact |
211 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27632254 |
aaatggatttggtgataaggaaatggaattaggacaagaatttaatagtataaatggatcaatatatgattataatccccagcaagaatatgatact |
27632158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University