View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11183_high_59 (Length: 206)
Name: NF11183_high_59
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11183_high_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 44615827 - 44615651
Alignment:
| Q |
19 |
gttcctccgccatagccctctccagagaggactcttttttcactttcatctctctttctatcgatttcacctcccatgtcttcctccgatgcccataccg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44615827 |
gttcctccgccatagccctctccagagaggactcttttttcactttcatctctctttctatcgatttcaccacccatgtcttcctccgatgcccataccg |
44615728 |
T |
 |
| Q |
119 |
cacccactaatatcaaccccaaatgtatcctcttcaatgctgcatccggtgcttccgctggtataccttcttctctc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44615727 |
cacccactaatatcaaccccaaatgtatcctcttcaatgctgcatccggtgcttccgctggtataccttcttttctc |
44615651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University