View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11183_low_15 (Length: 467)
Name: NF11183_low_15
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11183_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 415; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 11 - 449
Target Start/End: Original strand, 2925201 - 2925639
Alignment:
| Q |
11 |
cagagacagcagaacgagaaccttctcttgaactgaaattcccactaccaaccctatcagaacctgcaaccgcattcgaagacgaagaacgttgaaatct |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2925201 |
cagaaacagcagaacgagaaccttctcttgaactgaaattcccactaccaatcctatcagaacctgcaaccgcattagaagacgaagaacgttgaaatct |
2925300 |
T |
 |
| Q |
111 |
tctccttctcctatactcaaaacaaacacaaaccatatgaagaacacattgaagcacatatcccgcaatccacaatctcaacggcatttccggcgcttcg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2925301 |
tctccttctcctatactcaaaacaaacacaaaccatatgaagaacacattgaagcacatatcccgcaatccacaatctcaacggcatttccggcgcttcg |
2925400 |
T |
 |
| Q |
211 |
ttccggctcaaaaacaacgcggtccccgctacaatgacgaaggcgaagttccaaacgatatcgagaatcacaaccggcttcgaatacgcccaatcgcttt |
310 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2925401 |
ttccggctcaaaaacaaagcggtccccgctacaatgacgaaggcgaagttccaaacgatatcgagaatcacaaccggcttcgaatacgcccaatcgcttt |
2925500 |
T |
 |
| Q |
311 |
gtcgttcttctaattgctctgccgcggcttcgcgaacgacgacggagggttcccgcatcgttcgacggccgcttgcttgacgaaggaagcgtgcggcttg |
410 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2925501 |
gtcgttcttctaattgctcagccgcggcttcgcgaacgacgacggagggttcccgcatcgttcgacggccgcttgcttgacgaaggaagcgtgcggcttg |
2925600 |
T |
 |
| Q |
411 |
gaggaggcgttggcggcggcggcgaccggagttgttgag |
449 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2925601 |
gaggaggcgttggcggcgacggcgaccggagttgttgag |
2925639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 337
Target Start/End: Complemental strand, 42646300 - 42646231
Alignment:
| Q |
268 |
atatcgagaatcacaaccggcttcgaatacgcccaatcgctttgtcgttcttctaattgctctgccgcgg |
337 |
Q |
| |
|
||||| |||||||| |||||||||||||| |||||||| ||||| |||||||| |||||||| ||||||| |
|
|
| T |
42646300 |
atatcaagaatcaccaccggcttcgaataagcccaatcactttgccgttcttccaattgctcagccgcgg |
42646231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University