View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11183_low_20 (Length: 389)
Name: NF11183_low_20
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11183_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 20 - 378
Target Start/End: Original strand, 9285743 - 9286107
Alignment:
| Q |
20 |
atatgacatacattttgctcctttttgt-gaactaaatcttcgtgtcaatccattccgttgggttgcaccttttgtcaaatgaggatactaaannnnnnn |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9285743 |
atatgacatacattttgctcctttttgttgaactaaatcttcgtgtcaatccattccgttgggttgcaccttttgtcaaatgag-atactaaacttttt- |
9285840 |
T |
 |
| Q |
119 |
attgattattcacacaatatggttcgaatctataaatgaacatgcaccaaattccatacttaccgaccattgtagagcaatgnnnnnnntgcaatgtctt |
218 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9285841 |
attgattattcaca--atatggttcgaatctataaatgaacatgcaccaaattccatacttaccgaccattgtagagcaatgaaaaaaatgcaatgtctt |
9285938 |
T |
 |
| Q |
219 |
tgatcgacattggcgctggttgcaacatctaatgagaaaggtttcagaaaagttggatag---------ttatgagtctatcaaaacacttttgcatggt |
309 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9285939 |
tgatcgccatcggcgctggttgcaacatctaatgagaaaggtttcagaaaagttggataggcactgtgattatgagtctatcaaaacacttttgcatggt |
9286038 |
T |
 |
| Q |
310 |
gctagctatttatgatgcaccaaacttacctacatacttcaaagttcaaaccctatcagccatcttcat |
378 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9286039 |
gctagctctttatgatgcatcaaacttacctacatacttcaaagttcaaaccctatcagccatcttcat |
9286107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University