View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11183_low_31 (Length: 291)
Name: NF11183_low_31
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11183_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 17 - 275
Target Start/End: Complemental strand, 5925953 - 5925702
Alignment:
| Q |
17 |
agacaacaccaagagtagggatccacacctccataactatatacttgaatgatagtataatacatgcaataagtgtttgacgtgttacttctcatgtaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5925953 |
agacaacaccaagagtagggatccacacctccataactatatactt-attgatagtataatacatgcaataagtgtttgacgtgttacttctcatgtaca |
5925855 |
T |
 |
| Q |
117 |
agtacaagacacatgcatgatgcattcatgatattttggtgttgnnnnnnngatctaactcaatcctttgctttagaccaatcatatcatatttataaat |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5925854 |
agtacaagacacat-------gcattcatgatattttggtgttgaaaaaaagatctaactcaatcctttgctttagaccaatcatatcatatttataaat |
5925762 |
T |
 |
| Q |
217 |
aaatac-nnnnnnnnnnnaattgtgtgtcacttacacgaaaagttagagattagtctatt |
275 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5925761 |
aaatacattttttttttaaattgtgtgtcacttacacgaaaagttagagactagtctatt |
5925702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University