View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11183_low_33 (Length: 265)
Name: NF11183_low_33
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11183_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 177 - 218
Target Start/End: Complemental strand, 1470918 - 1470877
Alignment:
| Q |
177 |
ataccttcaaagttctctgatagctttgcttagttttatata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1470918 |
ataccttcaaagttctctgatagctttgcttagttttatata |
1470877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 177 - 218
Target Start/End: Complemental strand, 1472482 - 1472441
Alignment:
| Q |
177 |
ataccttcaaagttctctgatagctttgcttagttttatata |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1472482 |
ataccttcaaagttctctgattgctttgcttagttttatata |
1472441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University