View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11183_low_39 (Length: 250)

Name: NF11183_low_39
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11183_low_39
NF11183_low_39
[»] chr1 (1 HSPs)
chr1 (4-245)||(42661492-42661733)


Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 4 - 245
Target Start/End: Complemental strand, 42661733 - 42661492
Alignment:
4 atgtttcattggtaatttttagacagacactaacggaaaattatgaatttcagagccatgcatggatgacagaatctgagaaggaacaaatctgcaggct 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42661733 atgtttcattggtaatttttagacagacactaacggaaaattatgaatttcagagccatgcatggatgacagaatctgagaaggaacaaatctgcaggct 42661634  T
104 gatgaattgccagaaactctcattggaagcaagcacacacgcagctcaaaacgaaaggctaccacttcgtgttgttgtccaagttttgttcttcgaacaa 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42661633 gatgaattgccagaaactctcattggaagcaagcacacacgcagctcaaaacgaaaggctaccacttcgtgttgttgtccaagttttgttcttcgaacaa 42661534  T
204 ctcaagctacgcacatctgttgcaggttggttctctgcttct 245  Q
    |||||||||||||||||||||||||||||||||| |||||||    
42661533 ctcaagctacgcacatctgttgcaggttggttctttgcttct 42661492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University