View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11183_low_53 (Length: 233)
Name: NF11183_low_53
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11183_low_53 |
 |  |
|
| [»] scaffold0907 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0907 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: scaffold0907
Description:
Target: scaffold0907; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 77 - 213
Target Start/End: Complemental strand, 3102 - 2966
Alignment:
| Q |
77 |
tcattcgggtcagagaaatcatcattgaaaggatttggaagagctggaaatgaaggtgtagctgtggagaaagattctgatgacccttatcttgattttc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3102 |
tcattcgggtcagagaaatcatcattgaaaggatttggaagagctggaaatgaaggagtagctgtggagaaagattctgatgacccttatcttgattttc |
3003 |
T |
 |
| Q |
177 |
gacattcaatgttgcagatgatattggagaatgagat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3002 |
gacattcaatgttgcagatgatattggagaatgagat |
2966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 42945876 - 42945806
Alignment:
| Q |
140 |
gtggagaaagattctgatgacccttatcttgattttcgacattcaatgttgcagatgatattggagaatga |
210 |
Q |
| |
|
||||||||||||||||| || |||||||||||||| | ||||| ||| | || ||||||||||||||||| |
|
|
| T |
42945876 |
gtggagaaagattctgaagatccttatcttgatttcaggcattccatgcttcaaatgatattggagaatga |
42945806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University