View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11183_low_55 (Length: 230)

Name: NF11183_low_55
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11183_low_55
NF11183_low_55
[»] chr8 (2 HSPs)
chr8 (76-211)||(45362952-45363087)
chr8 (15-45)||(45363237-45363267)
[»] chr6 (1 HSPs)
chr6 (105-187)||(25040700-25040782)


Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 76 - 211
Target Start/End: Complemental strand, 45363087 - 45362952
Alignment:
76 taaacaccattgagtttgattgaatactaaccaagactgtacatggccatgccaagccctgcatctgacaatatggaaatagacttttctatgataacag 175  Q
    ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||    
45363087 taaacaccattgagttttattgaatactaaccaagactgaacatggccatgccaagccctgcatccgacaatatggaaatagactttgctatgataacag 45362988  T
176 gcatttcaatattccacctgaatgaaatgagtgacc 211  Q
    ||||||||||||||||||||||||||||||||||||    
45362987 gcatttcaatattccacctgaatgaaatgagtgacc 45362952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 45
Target Start/End: Complemental strand, 45363267 - 45363237
Alignment:
15 atgaacagaatcataaaggaaaaggagcaaa 45  Q
    |||||||||||||||||||||||||||||||    
45363267 atgaacagaatcataaaggaaaaggagcaaa 45363237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 187
Target Start/End: Complemental strand, 25040782 - 25040700
Alignment:
105 accaagactgtacatggccatgccaagccctgcatctgacaatatggaaatagacttttctatgataacaggcatttcaatat 187  Q
    |||||||||| |||| ||||||||||| |||||||||||||  ||||||||||||||| |||| ||  |||||||||||||||    
25040782 accaagactgaacatagccatgccaagtcctgcatctgacagaatggaaatagactttgctataatggcaggcatttcaatat 25040700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University