View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11183_low_58 (Length: 221)
Name: NF11183_low_58
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11183_low_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 203
Target Start/End: Original strand, 27112195 - 27112379
Alignment:
| Q |
17 |
tgaaaaacatgatgcataaatgaatgaatagggtaattaattagaaggtacagaatgaaattataccattaagataagggataggaatgtcatagtagta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27112195 |
tgaaaaacatgatgcataaatgaatgaagag--taattaatgagaaggtacaaaatgaaattataccattaagataagggataggaatgtcatagtagta |
27112292 |
T |
 |
| Q |
117 |
agtggagggtcttccaaaatcttcagagtatggtggagacagcacatctagtattgcacatggagtcaacgctctaaaagaatgaat |
203 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27112293 |
agtggagggtcttccaaaatcttcacagtatggtggagacagcacatctagtattgcacatggagtcaacgctctaaaagaatgaat |
27112379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University