View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11183_low_62 (Length: 206)

Name: NF11183_low_62
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11183_low_62
NF11183_low_62
[»] chr7 (1 HSPs)
chr7 (19-195)||(44615651-44615827)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 44615827 - 44615651
Alignment:
19 gttcctccgccatagccctctccagagaggactcttttttcactttcatctctctttctatcgatttcacctcccatgtcttcctccgatgcccataccg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
44615827 gttcctccgccatagccctctccagagaggactcttttttcactttcatctctctttctatcgatttcaccacccatgtcttcctccgatgcccataccg 44615728  T
119 cacccactaatatcaaccccaaatgtatcctcttcaatgctgcatccggtgcttccgctggtataccttcttctctc 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
44615727 cacccactaatatcaaccccaaatgtatcctcttcaatgctgcatccggtgcttccgctggtataccttcttttctc 44615651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University