View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11184_low_3 (Length: 313)
Name: NF11184_low_3
Description: NF11184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11184_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 221 - 303
Target Start/End: Original strand, 38932819 - 38932901
Alignment:
| Q |
221 |
tgcagaatgcgtgtttgcttgatcatcattaattaatgttttaaccaaataatctcacaagtcacaaatgtcatgcccctttg |
303 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38932819 |
tgcagaatgcatgtttgcttgatcatcattaattaatgttttaaccaaataatctcacaagtcactaatgtcatgcccctttg |
38932901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 25 - 102
Target Start/End: Complemental strand, 55827442 - 55827367
Alignment:
| Q |
25 |
tccttatcttcgtagattggttagctataattatatcatatcttatgcatcaagtgaagcgcaaaaacaatagcaatt |
102 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||| ||| |||||| ||||||||||| |
|
|
| T |
55827442 |
tccttattttcgtagattggttagctataattactgtatatcttatgcatcaaaagaa--gcaaaagcaatagcaatt |
55827367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University