View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11185_low_5 (Length: 230)
Name: NF11185_low_5
Description: NF11185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11185_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 16 - 215
Target Start/End: Complemental strand, 11156115 - 11155916
Alignment:
| Q |
16 |
gagacattgaaagcctttaaaatnnnnnnntctgacatggaagggctagtggttgacagagaagtacagttgccggacaaagatacatttgcaataacga |
115 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11156115 |
gagacattgaaagcctttaaaataaaaaaatatgacatggaacggccagtggttgacagagaagtacagttgccagacaaagatacatttgcaataacga |
11156016 |
T |
|
| Q |
116 |
aggtcactgccgaattcttggaaatctgtttgttattgaatctttggttatttctgcaaaaccaaattacattgacaatgttgacaatcgttgatcaaat |
215 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
11156015 |
aggtcactgtcgaattcttggaaatctgtttgttattgaatcttttgttatttctgcaaaaccaaattacattgacaatgttgacaattgctgatcaaat |
11155916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University