View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11187_high_3 (Length: 280)
Name: NF11187_high_3
Description: NF11187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11187_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 265
Target Start/End: Original strand, 45741133 - 45741381
Alignment:
| Q |
19 |
ataaccctgttaacctgggaaagtatataggaatatattgcgtgagatgtcatctatgaactatgatagtaatgtcattctccatttagtttgccaggtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45741133 |
ataaccctgttaacctgggaaagtatataggaatatattgcgtgatatgtcatctatgaactatgatagtaatgtcattctccatttagattgccaggtt |
45741232 |
T |
|
| Q |
119 |
gtcgtgttagatgactagatactct--acgctgtcaagagggtaggtgaaaaattcaaacctcagtccagttttgaatttaattaagttttgaaggatat |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45741233 |
gtcgtgttagatgactagatactctctacgctgtcaagagggtaggtgaaaaattcaaacctcagtccagttttgaatttaataaagttttgaaggatat |
45741332 |
T |
|
| Q |
217 |
atctatgtactaatgcaattttgaagatgctcctgttagaaaactgtcc |
265 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45741333 |
atctatgaactaatgcaattttgaagatgctcctgttagaaaactgtcc |
45741381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University