View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11187_high_4 (Length: 265)
Name: NF11187_high_4
Description: NF11187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11187_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 17 - 255
Target Start/End: Complemental strand, 26937644 - 26937411
Alignment:
| Q |
17 |
actagctttagaattttcacggcgactgtgcattgggacgcagtattggattgactaacgtgtatccaaaggccaagttgttttgcgaaagacatgctat |
116 |
Q |
| |
|
|||||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |||||||| |
|
|
| T |
26937644 |
actagcttcagaattttcacggtgaccgtgcattgggacgcagtattggattgactaacgtgtatccaaagtctaagttgttttgcga----catgctat |
26937549 |
T |
|
| Q |
117 |
ttaannnnnnnnnnacttggaccatattattaaccatgtcttttcaacatgagaaataaaaacaagtctaccaagtattttgttcactgttcagacacct |
216 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26937548 |
ttt-ttttttttttacttggaccatattattaaccatgtcttttcaacatgagaaataaaaacaagtctaccaagtattttgttcactgttcagacacct |
26937450 |
T |
|
| Q |
217 |
tgagtgaaattgtattaattgaagatatatgcatctgtg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26937449 |
tgagtgaaattgtattaattgaagatatatgcatttgtg |
26937411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 86
Target Start/End: Original strand, 8917610 - 8917678
Alignment:
| Q |
18 |
ctagctttagaattttcacggcgactgtgcattgggacgcagtattggattgactaacgtgtatccaaa |
86 |
Q |
| |
|
||||||| |||||||||||| ||| ||||||||||| || ||||||||||||| ||| ||| |||||| |
|
|
| T |
8917610 |
ctagcttcagaattttcacgacgaaagtgcattgggatgcggtattggattgacaaacatgtttccaaa |
8917678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 17 - 86
Target Start/End: Original strand, 26135549 - 26135618
Alignment:
| Q |
17 |
actagctttagaattttcacggcgactgtgcattgggacgcagtattggattgactaacgtgtatccaaa |
86 |
Q |
| |
|
|||||||| ||||||||||||| || |||||||||||||| ||||| ||||| | |||| |||||||| |
|
|
| T |
26135549 |
actagcttctgaattttcacggcaaccgtgcattgggacgcggtattagattggcaaacgcttatccaaa |
26135618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 20791085 - 20791137
Alignment:
| Q |
17 |
actagctttagaattttcacggcgactgtgcattgggacgcagtattggattg |
69 |
Q |
| |
|
|||||||| |||||| ||||||| || |||||||||||||| ||| ||||||| |
|
|
| T |
20791085 |
actagcttcagaattctcacggcaaccgtgcattgggacgcggtaatggattg |
20791137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University