View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11188_low_5 (Length: 263)
Name: NF11188_low_5
Description: NF11188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11188_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 45064666 - 45064900
Alignment:
| Q |
18 |
gaagagttctgtccatattaagtttgaaacatccttcagactttcactcatgctgatacacaaggtaattccacaacacatgaaaaattgtaccacaatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45064666 |
gaagagttctgtccatattaagtttgaaacatccttcagaccttcactcatgctgatacacaaggtaattccacaacacatgaaaaattgtaccacaatg |
45064765 |
T |
 |
| Q |
118 |
cttgtgcatgtagttcataatatgtaactagttcacaggatgttttataatcgaacgagaaaatatcagaacaatgaagatgctaaaagttgattgaagg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45064766 |
cttgtgcatgtagttcataatatgtaactagttcacaggatgttttataatcggacgagaaaatatcagaacaatgaagatgctaaaagttgattgaagg |
45064865 |
T |
 |
| Q |
218 |
aagaaactcacaggaatccttataacatcgtctct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45064866 |
aagaaactcacaggaatccttataacatcgtctct |
45064900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University